Common Design vs. Common Descent

I promised John Harshman for several months that I would start a discussion about common design vs. common descent, and I’d like to keep my word to him as best as possible.

Strictly the speaking common design and common descent aren’t mutually exclusive, but if one invokes the possibility of recent special creation of all life, the two being mutually exclusive would be inevitable.

If one believes in a young fossil record (YFR) and thus likely believes life is young and therefore recently created, then one is a Young Life Creationist (YLC). YEC (young earth creationists) are automatically YLCs but there are a few YLCs who believe the Earth is old. So evidence in favor of YFR is evidence in favor of common design over common descent.

One can assume for the sake of argument the mainstream geological timelines of billions of years on planet Earth. If that is the case, special creation would have to happen likely in a progressive manner. I believe Stephen Meyer and many of the original ID proponents like Walter Bradley were progressive creationists.

Since I think there is promising evidence for YFR, I don’t think too much about common design vs. common descent. If the Earth is old, but the fossil record is young, as far as I’m concerned the nested hierarchical patterns of similarity are due to common design.

That said, for the sake of this discussion I will assume the fossil record is old. But even under that assumption, I don’t see how phylogenetics solves the problem of orphan features found distributed in the nested hierarchical patterns of similarity. I should point out, there is an important distinction between taxonomic nested hierarchies and phylogenetic nested hierarchies. The nested hierarchies I refer to are taxonomic, not phylogenetic. Phylogeneticsits insist the phylogenetic trees are good explanations for the taxonomic “trees”, but it doesn’t look that way to me at all. I find it revolting to think giraffes, apes, birds and turtles are under the Sarcopterygii clade (which looks more like a coelacanth).

Phylogeny is a nice superficial explanation for the pattern of taxonomic nested hierarchy in sets of proteins, DNA, whatever so long as a feature is actually shared among the creatures. That all breaks down however when we have orphan features that are not shared by sets of creatures.

The orphan features most evident to me are those associated with Eukaryotes. Phylogeny doesn’t do a good job of accounting for those. In fact, to assume common ancestry in that case, “poof” or some unknown mechanism is indicated. If the mechanism is unknown, then why claim universal common ancestry is a fact? Wouldn’t “we don’t know for sure, but we believe” be a more accurate statement of the state of affairs rather than saying “universal common ancestry is fact.”

So whenever orphan features sort of poof into existence, that suggests to me the patterns of nested hierarchy are explained better by common design. In fact there are lots of orphan features that define major groups of creatures. Off the top of my head, eukaryotes are divided into unicellular and multicellular creatures. There are vetebrates and a variety of invertebrates. Mammals have the orphan feature of mammary glands. The list could go on and on for orphan features and the groups they define. Now I use the phrase “orphan features” because I’m not comfortable using formal terms like autapomorphy or whatever. I actually don’t know what would be a good phrase.

So whenever I see an orphan feature that isn’t readily evolvable (like say a nervous system), I presume God did it, and therefore the similarities among creatures that have different orphan features is a the result of miraculous common design not ordinary common descent.

5,163 thoughts on “Common Design vs. Common Descent”

  1. Allan Miller: You do realise that you are effectively arguing that everyone in the entire field of molecular systematics is just plain dumb?

    Well, it depends Allan. Some are atheists, hence they take the one-eyed approach to science typical of their (your) ilk when it impinges on their religion.

  2. Allan Miller,

    There is no correlation between uncorrelated parts of the genome, of course. In the photocopier example, there is no correlation between the marks. If one adds an analogue of speciation *** – takes some of the papers to the photocopier next door – one still has the phylogenetic information, till the entire thing gets covered in toner flecks.

    Yes, if one thats the paper next store the error types then separate into photocopier number 1 error and then photocopier number 2 error. Photocopier errors no longer shared by the 2 populations of copies. We now have Rums scenario because inheritance is out of the picture. Un correlated errors to the copies of each population. Rums scenario is simply selected arbitrary changes to the sequence. Maybe the nested hierarchy is the signature of design. The signature of non random changes that forms two separate species.

  3. phoodoo:

    Allan Miller: You do realise that you are effectively arguing that everyone in the entire field of molecular systematics is just plain dumb?

    Well, it depends Allan. Some are atheists, hence they take the one-eyed approach to science typical of their (your) ilk when it impinges on their religion.

    The biologists who, around 1800, started to have strong suspicions that groups of animals and of plants did not have each species separately created were not atheists. But they were not blinded by seeing this, even though it impinged on their religion.

    The same for the geologists who concluded in favor of an old earth, at about the same time.

  4. colewd:

    Yes, if one thats the paper next store the error types then separate into photocopier number 1 error and then photocopier number 2 error.

    This resembles the terrestrial language known as English, but looks can be deceiving.

  5. Joe Felsenstein,

    I didn’t say they were, I said the ones who are atheist. Because clearly you can’t be an atheist and be a good scientist. Just ask Allan.

    November 14, 2017 at 6:28 pm
    Ignored

    stcordova,

    Credential mongering. I could show you the credentials of people who think Creationism utter bunk. Would that persuade you one iota of the validity of their arguments?

    Sanford has made real advances, but – sorry to do the Reverse Argument From Authority – he is a Creationist and hence takes the one-eyed approach to science typical of his (your) ilk when it impinges on his religion.

  6. Joe Felsenstein: The biologists who, around 1800, started to have strong suspicions that groups of animals and of plants did not have each species separately created were not atheists. But they were not blinded by seeing this, even though it impinged on their religion.

    If they believe in the fixity of species it was because of their science, not their religion. There is certainly nothing in the bible that demands that every species be individually and specially created.

    Surely even biblical creationists would understand that only a small number of actual species would fit on the ark.

    So your argument, Joe, makes no sense.

  7. phoodoo: Well, it depends Allan.Some are atheists, hence they take the one-eyed approach to science typical of their (your) ilk when it impinges on their religion.

    Teach us ,oh wise pHoodoo, the true meaning of science.

    ETA sorry phoo, you were mocking, slightly out of context

  8. colewd:
    Allan Miller,

    A cause a effect relationship.

    The claim is a nested hierarchy is caused by inheritance yet according to the theory speciation occurs with isolated populations.Once the populations become isolated then random mutation starts to break down correlation and I would expect Rum’s result.

    No. I’m going to do it. I will make three gene sequences, and then I will evolve them by splitting, copying and introduce random mutation (using a dice-roller to determine which nucleotide position to mutate, and another dice roller to determine how it mutates) until we have 10 “species”. Then I will “evolve” those 10 species for a few generations with random deaths, copying of survivors and more random mutations. Then I’m going to make trees for all three genes and see if they match.

    So there will be three levels of randomness.
    1. Who gets to survive and who gets to die will be dermined randomly.
    2. What nucleotide position mutates with be determined randomly.
    3. What type of mutation it will be, will be dermined randomly.

    Then I’m going to make trees for all three genes and see if they match. Then you will see the result. See you later.
    (Edited for clarification).

  9. phoodoo,

    Well, it depends Allan. Some are atheists, hence they take the one-eyed approach to science typical of their (your) ilk when it impinges on their religion.

    When all else fails, try parroting your opponent’s post and flipping a couple of words. Well done again.

  10. colewd: Yes, if one thats the paper next store the error types then separate into photocopier number 1 error and then photocopier number 2 error. Photocopier errors no longer shared by the 2 populations of copies.

    Mikkel is going to get his hands dirty. Do you have access to a photocopier, a stack of A4 and a ballpoint (for playing designer)? You can join him then.

  11. Mung,

    If the shoe fits …

    Mung1: I accept common descent.
    Mung 2: (by insinuation) all molecular systematists are dumb.

    I’d be giving Mung too much credit to suggest that maybe the game is to show that if someone accepts phylogenies on the peculiar grounds Mung accepts them (not, it appears, informed by anything from systematics), it really is a heap o’crap!

  12. Mung: Surely even biblical creationists would understand that only a small number of actual species would fit on the ark.

    Oh good, for a moment I thought they were being irrational.

  13. colewd,

    Yes, if one thats the paper next store [sic] the error types then separate into photocopier number 1 error and then photocopier number 2 error. Photocopier errors no longer shared by the 2 populations of copies. We now have Rums scenario because inheritance is out of the picture.

    But if there has been any copying prior to the separation, that is shared by the two copying streams. That’s the whole point. This is just a single node on a tree. I can’t believe, after all this time, you are struggling with this. Forget ratites and Theobald, this is very basic.

    ‘Copier 2’ errors are not diagnostic of a relationship to the ‘copier 1’ lineage. It’s the marks shared with the ‘copier 1 lineage’ that are diagnostic. Of course, if you just started from scratch in each room, you have gone for a model of special creation, which is something else. You need a period of copying a lineage, to get some common errors, then separate and carry on in each room. Maybe split again, copier 3, copier 4 …. all marks in any line of descent are retained, and so the phylogeny can be reconstructed, as if by magic.

  14. Rumraket: No. I’m going to do it. I will make three gene sequences, and then I will evolve them by splitting, copying and introduce random mutation (using a dice-roller to determine which nucleotide position to mutate, and another dice roller to determine how it mutates) until we have 10 “species”. Then I will “evolve” those 10 species for a few generations with random deaths, copying of survivors and more random mutations. Then I’m going to make trees for all three genes and see if they match.

    So there will be three levels of randomness.
    1. Who gets to survive and who gets to die will be dermined randomly.
    2. What nucleotide position mutates with be determined randomly.
    3. What type of mutation it will be, will be dermined randomly.

    Then I’m going to make trees for all three genes and see if they match. Then you will see the result. See you later.
    (Edited for clarification).

    I have now generated the evolutionary history and the common ancestral genome.

    The genome of the universal ancestor is:
    Gene_1: AAGGCCCCATATCCTCTCCG
    Gene_2: GAATACCGTTCCGGAGGGAT
    Gene_3: GCGCACCTACTTCTCGTAAG

    Here’s the evolutionary history generated by randomly determining deaths, this universal ancestor and it’s descendants will go through: https://i.imgur.com/aWJ3jOa.jpg?1

    Now I will have to incrementally copy and randomly mutate the sequences according to this history.

  15. Allan Miller: Well, it depends Allan. Some are atheists, hence they take the one-eyed approach to science typical of their (your) ilk when it impinges on their religion.

    When all else fails, try parroting your opponent’s post and flipping a couple of words. Well done again.

    Yes, its so unfair for me to replace creationist with atheist. Because that’s an outrageous statement! Its one thing to say creationists are biased, but to say atheist are-Now that’s out of line!

    Thanks for the laugh today Allan.

  16. phoodoo,

    Yes, its so unfair for me to replace creationist with atheist. Because that’s an outrageous statement! Its one thing to say creationists are biased, but to say atheist are-Now that’s out of line!

    No, it’s not unfair. Pathetic was more what I was going for. I don’t object to the reversal per se, I just find it whiny. At which point you whine: “but your original statement was whiny!”, like a good parrot.

  17. Okay Bill, here are the results.

    These are the gene-sequences for the surviving organisms.
    Gene1:
    Species_15 AAGGCCCCTTATCCTCTCCC
    Species_20 AAGGCCCCTTATCCACTCCC
    Species_10 AAGGCCCCAGATTCTCGCCG
    Species_21 AAGGCTCCAGATTCTCGCCG
    Species_11 AAGGACCCAGCTTCTCTCCG
    Species_22 AAGGACCCCGCTTCTCTCCG
    Species_4 TAGGCACAATATCCTCTCCG
    Species_23 TAGGCACAAAATCCTCTCCG
    Species_19 TAGGCACAATGGCCTCTCCG
    Species_24 TAGGCACAATGGCCTCTTCG

    Gene2:
    Species_15 GAATGCCGTTTCGGAGGGAT
    Species_20 GAATGCAGTTTCGGAGGGAT
    Species_10 GAATAGCGTTCCGGCGAGAT
    Species_21 GAATAGCATTCCGGCGAGAT
    Species_11 CAATAGCGTTCCGGACAGAT
    Species_22 GAATAGCGTTCCGGACAGAT
    Species_4 GAATACCGTTCCGGAGAGAT
    Species_23 GAATACCGTTCCGGAGAGAG
    Species_19 GGATACCGTTCCGGAGACAT
    Species_24 GGATACCTTTCCGGAGACAT

    Gene3:
    Species_15 GCGCTCCTACTTCTCGTAAG
    Species_20 GCGCCCCTACTTCTCGTAAG
    Species_10 GCGCTCCGTCTTCTCGTAAG
    Species_21 GCGCTCCGTTTTCTCGTAAG
    Species_11 GCGCTCCGACCTCTCGTAAC
    Species_22 GCGCTCCGACCTCTCGCAAC
    Species_4 CCGCACCTACTGCTCGTTAG
    Species_23 CCGCACCTACTACTCGTTAG
    Species_19 CCGCACCTACAGCTCGTTTG
    Species_24 CCGCACCTACTGCTCGTTTG

    I submitted all three lists to the maximum parsimony algorithm here: http://www.trex.uqam.ca/index.php?action=phylip&app=dnapars

    All three gene lists yielded a single best tree.
    Gene 1 tree.
    Gene 2 tree.
    Gene 3 tree.

    Here’s a comparison so you can see them side by side.
    Comparison of all three trees.
    How similar are those trees? Are some organisms systematically grouped together in all three trees? Yes they are. In fact all of them are. These trees are nearly identical.

    In all three trees species 19 and 24 are close together.
    In all three trees 23 and 4 are close together.
    In all three trees 15 and 20 are close together.
    In all three trees 10 and 21 are close together.
    In all three trees 11 and 22 are close together.

    But there’s even more recurrent hierarchical structure across the trees than that. In all three trees, 10, 11, 20 and 22 are close together and fall into a similar “clade”. The same is true for a clade that contains the members 4, 19, 23 and 24.

    Now, compare those clades to the hypothetical evolutionary history I generated to begin with. For all three genes, the trees that the algorithm derives from them are very close to the actual history I generated.

    In every concievable way, your intuition has failed you.

  18. Allan Miller,

    ‘Copier 2’ errors are not diagnostic of a relationship to the ‘copier 1’ lineage. It’s the marks shared with the ‘copier 1 lineage’ that are diagnostic.

    Sure but this is not the claim. Most genes I take from the two lineages will follow the pattern of the tree. Where if fact genes that have diverged after the split should not unless the change is the result of design.

  19. Rumraket,

    Now I will have to incrementally copy and randomly mutate the sequences according to this history.

    If you are mutating according to history it is by definition not random.

  20. colewd:
    Rumraket,

    If you are mutating according to history it is by definition not random.

    You misunderstand there. The history doesn’t tell me which mutations to make or where to make them. The history was only made up before hand so I don’t need to generate mutations in the genomes of organisms that go extinct. It was simply done to save work, not because it affects the outcome. There’s no reason to sit there and incrementally copy and mutate genomes, only to find out by dice-rolls later on that I’ve made a long lineage of genomes that goes extinct, and therefore won’t make it to the last generation used in the phylogenetic analysis.

    I simply made up the history first, randomly I might add by using dice to decide which organisms live and which organisms die. Then I copied the genomes and used dice to determine which location in the gene to mutate, and dice to determine which nucleotide to substitute with.

    Whether I generate a sequence, then mutate it, or whether I make a plan on a piece of paper first, and THEN generate a sequence, copy and mutate it, is completely equivalent.

    I could have done it all incrementally, without making the plan first, it would just have taken more time then.

  21. colewd,

    Sure but this is not the claim. Most genes I take from the two lineages will follow the pattern of the tree. Where if fact genes that have diverged after the split should not unless the change is the result of design.

    Don’t know what you are saying here. It’s the genes that follow the tree = ‘most genes’ – that we are talking about. You appeared to claim that two independently-picked genes would not be expected to follow the tree. But they clearly would, if they both come from the same common ancestors prior to a split. Hence the photocopier lineages.

    Clearly, things that happen after a split tell us nothing about situations prior to it.

  22. Rumraket,

    I simply made up the history first, randomly I might add by using dice to decide which organisms live and which organisms die. Then I copied the genomes and used dice to determine which location in the gene to mutate, and dice to determine which nucleotide to substitute with.

    At what point in this simulation does the population split where the copy process becomes two copying process.

  23. Allan Miller,

    But they clearly would, if they both come from the same common ancestors prior to a split. Hence the photocopier lineages.

    After the split random change will create tree divergence with random change. If the change is random we will see changes in some genes and none in others yet in the human chimp split 70% of the protein coding genes have changes. In each mutation there is only one in 10 million chance that a specific gene is affected and much less that fixation will occur.

  24. colewd:
    Allan Miller,

    After the split random change will create tree divergence with random change.If the change is random we will see changes in some genes and none in others yet in the human chimp split 70% of the protein coding genes have changes.In each mutation there is only one in 10 million chance that a specific gene is affected and much less that fixation will occur.

    This isn’t all that difficult. If the average sequence difference is 1.3%, each gene, on average, should differ by 1 in 77 bases. It happens that protein-coding sequences are not evolving neutrally, so the actual difference is only about 1 in every 200 bases, heavily weighted toward silent changes. Mutations are stochastic and happen all the time, so though a given mutation has a very low chance of becoming fixed, there are so many that some mutations become fixed in each gene, and a few of those alter amino acids. The variance in fixation is not great enough that we would expect some genes to have zero changes. Most of those differences are probably neutral. The point is that it’s no surprise at all that 70% of proteins differ by one or more amino acids between chimp and human.

  25. John Harshman: The point is that it’s no surprise at all that 70% of proteins differ by one or more amino acids between chimp and human.

    When you are telling a story, nothing is a surprise to the person telling the story.

    Well, perhaps to some of our new guests they would still be surprised, even if they were the one who made up the story.

    Entropy.

  26. Mung: Now code it up for us mr. dazz.

    If someone here can code, I imagine in my ignorance of coding, that it would be pretty trivial to code a program that basically just simulates a copying+mutation process similar to the one I made up.

  27. colewd,

    After the split random change will create tree divergence with random change. If the change is random we will see changes in some genes and none in others yet in the human chimp split 70% of the protein coding genes have changes. In each mutation there is only one in 10 million chance that a specific gene is affected and much less that fixation will occur.

    You seem to think that after a gene has changed there’s nothing left of its prior state. That would be silly. Even changed genes retain information. If two genes are 99.9% identical, you want to remove them from analysis because of that teensy 0.1%.

  28. colewd: f the change is random we will see changes in some genes and none in others yet in the human chimp split 70% of the protein coding genes have changes.

    Why does colewd think this is not what is expected? Depending on the number of changes that have occurred overall, we can work out what fraction of genes are expected to have changes. Why does colewd think that with no amount of random change can we get 70% of genes having changes?

    If there are 20,000 boxes, and I toss balls randomly into the boxes, the chance that a particular box is missed is 19999/20000 per toss. With n tosses the chance that the box is missed all n times is (19999/20000)^n. When n = 24079 the chance that a given box is still empty is very close to 30%. So after about this many changes in a genome of 20,000 genes, we expect 70% of the genes to have changes.

  29. Joe Felsenstein: Why does colewd think that with no amount of random change can we get 70% of genes having changes?

    Terminology may be important here. It’s 70% of proteins that have changes, i.e. differences in amino acid sequence, not 70% of genes. I would expect that nearly every gene has changes, either silent changes in protein-coding exons or changes in non-coding parts of the gene, or both.

  30. John Harshman,

    We can either confine ourselves to protein sequence, or to DNA sequences. I think that you will agree that, either way, there is some amount of random change that leads us to expect that 70% of the genes will turn out to have changes.

    Somehow colewd has concluded otherwise, and I was trying to find out why.

  31. Thanks for the work Rumraket.

    Here is a link to an enlarged graph of your trees:

    http://theskepticalzone.fr/wp-content/uploads/2017/10/Comparison-1024×345.png

    For the User’s and my benefit I reformatted Rumrake’ts gene1 in FASTA format:

    >Gene1: Species_15
    AAGGCCCCTTATCCTCTCCC

    >Gene1: Species_20
    AAGGCCCCTTATCCACTCCC

    >Gene1: Species_10
    AAGGCCCCAGATTCTCGCCG

    >Gene1: Species_21
    AAGGCTCCAGATTCTCGCCG

    >Gene1: Species_11
    AAGGACCCAGCTTCTCTCCG

    >Gene1: Species_22
    AAGGACCCCGCTTCTCTCCG

    >Gene1: Species_4
    TAGGCACAATATCCTCTCCG

    >Gene1: Species_23
    TAGGCACAAAATCCTCTCCG

    >Gene1: Species_19
    TAGGCACAATGGCCTCTCCG

    >Gene1: Species_24
    TAGGCACAATGGCCTCTTCG

    I did a MEGA6.0 run and got essentially the same tree as Rumraket under these parameters:

    Figure. Molecular Phylogenetic analysis by Maximum Likelihood method
    The evolutionary history was inferred by using the Maximum Likelihood method based on the Tamura-Nei model [1]. The tree with the highest log likelihood (-103.0444) is shown. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The analysis involved 10 nucleotide sequences. Codon positions included were 1st+2nd+3rd+Noncoding. There were a total of 20 positions in the final dataset. Evolutionary analyses were conducted in MEGA6 [2].

    The tree from my run:

    http://theskepticalzone.fr/wp-content/uploads/2017/11/rumraket_1.png

  32. Just a question from an ignorant layman. Is it possible to have a change in a coding sequence that does not result in a change to the protein sequence?

    Is it possible to have a change to the protein sequence that does not affect function?

  33. Petrushka:

    Just a question from an ignorant layman. Is it possible to have a change in a coding sequence that does not result in a change to the protein sequence?

    Is it possible to have a change to the protein sequence that does not affect function?

    Emphatic yes to first question. The reason is easily visualized by looking at the genetic code:

    https://plato.stanford.edu/entries/information-biological/GeneticCode.png

    Yes to 2nd, although I argue the 2nd scenario isn’t as easy as others here will argue it is.

  34. Joe Felsenstein:
    John Harshman,

    We can either confine ourselves to protein sequence, or to DNA sequences.I think that you will agree that, either way, there is some amount of random change that leads us to expect that 70% of the genes will turn out to have changes.

    Somehow colewd has concluded otherwise, and I was trying to find out why.

    I think it’s a matter of “try anything and everything to destroy evolution,” and whenever one fails go on to another one.

    I can’t see any other logic behind his thinking.

    Glen Davidson

  35. Joe Felsenstein:
    John Harshman,

    We can either confine ourselves to protein sequence, or to DNA sequences.I think that you will agree that, either way, there is some amount of random change that leads us to expect that 70% of the genes will turn out to have changes.

    In fact 70% of proteins being different is a much lower percentage than expected from random changes. One would have to invoke negative selection to get the number down that low. That’s why protein-coding DNA sequences are only 0.5% different between chimps and humans, and those differences are concentrated in silent sites.

    Somehow colewd has concluded otherwise, and I was trying to find out why.

    Well, that last bit is simple: he’s looking for anything he can turn into an argument against evolution, and he isn’t examining his finds very carefully, because if he did there’s the danger they might turn out not to be finds.

  36. petrushka: Just a question from an ignorant layman. Is it possible to have a change in a coding sequence that does not result in a change to the protein sequence?

    Is it possible to have a change to the protein sequence that does not affect function?

    Yes and yes.

    Since several different codons code for the same amino acids (there are 20 amino acids and 64 codons), that gives quite some wiggle room for DNA mutations to not alter the protein sequence.

    For the latter part, there are usually several sites in a protein where changing an amino acid has little to no effect on function, provided it is changed into an amino acid that is chemically similar.

    Biochemists have defined something called the “physicochemical distance” that gives a measure of how physically and chemically different one amino acid is from another. If the distance (in terms of this physicochemical measure) is small between two amino acids, this increases the likelihood that the protein can tolerate one being substituted for another.

  37. As a piece of evidence for evolution and common descent, the amino acid differences between closely related species usually also correspond to short-distance substitutions.

  38. Referring to the distance matrix I provided in the previous comment which gives a measure of the differences between sequences. A bigger number is a bigger percent difference.

    http://theskepticalzone.fr/wp-content/uploads/2017/11/rumraket1_distances.txt

    species 21 vs 10 : 4.2%
    species 10 vs 24: 47.6%
    species 21 vs 24: 47.2%

    A triangle diagram (NOT TO SCALE):
    http://theskepticalzone.fr/wp-content/uploads/2017/11/rumraket1_triangle.png

    Now, doesn’t this bring to mind a complaint about fish-to-man evolution?

    Common Design vs. Common Descent

    It highlights what looks to me the dubious nature of some of the phylogenetic trees that are pumped out and the ad hoc rationalization used to justify them.

  39. Rumraket,

    As a piece of evidence for evolution and common descent, the amino acid differences between closely related species usually also correspond to short-distance substitutions.

    That Designer sho’ has its work cut out mimicking evolution.

  40. Allan Miller:
    Rumraket,

    That Designer sho’ has its work cut out mimicking evolution.

    It makes sense to Design using recent code. Would you remember where you left something you last used many millions of years ago? No, right? right? riiiiight?

  41. Sal’s working hard to obfuscate here. In the process, completely missing the point that all three trees are nearly identical.

    Anyway. Sal, the species names do not indicate their degree of relatedness. Go back and look at the overall plan I made.

    Species 10 really is much closer related to species 21. In point of fact, species 21 is the direct descendant of species 10.

  42. stcordova: In the link below is a nucleotide distance matrix for Rumraket’s Gene 1. Earlier for amino acids I used Jones-Taylor-Thornton which is the default for MEGA 6.0. For nucleotides the default is Maximum Composite Likelihood.

    The problem here is that, I suspect, the Maximum Composite Likelihood nucleotide distance measure probably has some substitution bias (so it weighs some substitutions as being of greater distance than others), which would explain why you get a tiiiny bit bigger distance between 10 and 24 (47.6%), compared to 21 and 24 ( 47.2%).

    But I did not simulate any substitution bias. All substitutions were equiprobable as I just used an 4-sided die roller (from https://roll20.net/) with 1 = A, 2 = G, 3 = C, 4 = T. If I rolled a substitution in the sequence that corresponded to a nucleotide already present, I just rolled again.

    Long story short, my “simulation” doesn’t have any intrinsic transition bias.

  43. Rumraket: Since several different codons code for the same amino acids (there are 20 amino acids and 64 codons), that gives quite some wiggle room for DNA mutations to not alter the protein sequence.

    For the latter part, there are usually several sites in a protein where changing an amino acid has little to no effect on function, provided it is changed into an amino acid that is chemically similar.

    This appears to be a specific definition of Wagner’s “Library of Babel” metaphor.

    Many alleles are synonyms or close enough synonyms. Sequences can wander without losing function.

    Wagner also asserted that synonymous sequences might differ in their tolerance of further mutations. That is to say, sequence AAAAB might be synonymous with AACAB, and Sequence AAAAZ might not be synonymous with AACAZ. but might tolerate AAXAZ.

    Something along those lines. The point being that sequences can diverge indefinitely, and two dissimilar sequences can have a common ancestor.

Leave a Reply